awk unix - match regex - regex string size limit | ideas?

As Jonathan Leffler points out in comments your issue in the first case (bash: /usr/bin/awk: Argument list too long) is from the shell and you can solve that by putting your awk script in a file.

As he also points out, your fundamental approach is not optimal. Below are two alternatives.

Perl has many features that will aid you with this.

You can use the ^ XOR operator on two strings that will return \x00 where the strings match and another character where they don't match. March through the longer string XORing against the shorter with a max substitution count and there you are:

use strict;
use warnings;
use 5.014;

my $seq = "CGCCCGAATCCAGAACGCATTCCCATATTTCGGGACCACTGGCCTCCACGGTACGGACGTCAATCAAAT";
my $pat     = "AAAAAA";
my $max_subs = 3;

my $len_in  = length $seq;
my $len_pat = length $pat;
my %posn;

sub strDiffMaxDelta {
    my ( $s1, $s2, $maxDelta ) = @_;
    
    # XOR the strings to find the count of differences
    my $diffCount = () = ( $s1 ^ $s2 ) =~ /[^\x00]/g;
    return $diffCount <= $maxDelta;
}

for my $i ( 0 .. $len_in - $len_pat ) { 
    my $substr = substr $seq, $i, $len_pat;
    # save position if there is a match up to $max_subs substitutions
    $posn{$i} = $substr if strDiffMaxDelta( $pat, $substr, $max_subs );
}

say "$_ => $posn{$_}" for sort { $a <=> $b } keys %posn;

Running this prints:

6 => AATCCA
9 => CCAGAA
10 => CAGAAC
11 => AGAACG
13 => AACGCA
60 => CAATCA
61 => AATCAA
62 => ATCAAA
63 => TCAAAT

Substituting:

$seq=AAATCGAAAAGCDFAAAACGT;
$pat=AATC;
$max_subs=1;

Prints:

1 => AATC
8 => AAGC
15 => AAAC

It is also easy (in the same style as awk) to convert this to 'magic input' from either stdin or a file.

You can also write a similar approach in awk:

echo "AAATCGAAAAGCDFAAAACGT" | awk -v mc=1 -v seq="AATC" '
{
for(i=1; i<=length($1)-length(seq)+1; i++) {
    cnt=0
    for(j=1;j<=length(seq); j++) 
        if(substr($1,i+j-1,1)!=substr(seq,j,1)) cnt++
    if (cnt<=mc) print i-1 " => " substr($1,i, length(seq)) 
    }
}'

Prints:

1 => AATC
8 => AAGC
15 => AAAC

And the same result with the longer example above. Since the input is moved to STDIN (or a file) and the regex does not need to be HUGE, this should get you started either with Perl or Awk.

(Be aware that the first character of a string is offset 1 in awk and offset 0 in Perl...)

Is there another way to approach this?

Looking for fuzzy matches is easy with Python. You just need to install the PyPi regex module by running the following in the terminal:

pip install regex # or pip3 install regex

and then create the Python script (named, say, script.py) like

#!/usr/bin/env python3
import regex
filepath = r'myfile.txt'
with open(filepath, 'r') as file:
    for line in file:
        for x in regex.finditer(r"(?:AATC){s<=1}", line):
            print(f'{x.start()}:{x.group()}')

Use the pattern you want, here, (?e)(?:AATC){s<=1} means you want to match AATC char sequence allowing one substitution at most in the match, with (?e) attempting to find a better fit.

Run the script using python3 script.py.

If myfile.txt contains just one AAATCGAAAAGCDFAAAACGT line, the output is

1:AATC
8:AAGC
15:AAAC

meaning that there are three matches at positions 1 (AATC), 8 (AAGC) and 15 (AAAC).

You can get the values themselves by replacing x.start() with x.group() in the Python script.

See an online Python demo:

import regex
line='AAATCGAAAAGCDFAAAACGT'
for x in regex.finditer(r"(?:AATC){s<=1}", line):
    print(f'{x.start()}:{x.group()}')

The "Argument list too long" problem is not from Awk. You're running into the operating system's memory size limit on the argument material that can be passed to a child process. You're passing the Awk program to Awk as a very large command line argument.

Don't do that; put the code into a file, and run it with awk -f file, or make the file executable and put a #!/usr/bin/awk -f or similar hash-bang line at the top.

That said, it's probably not such such great idea to include your data in the program source code as a giant literal.