Regular expression matching a multiline block of text

Viewed 341787

I'm having a bit of trouble getting a Python regex to work when matching against text that spans multiple lines. The example text is ('\n' is a newline)

some Varying TEXT\n
\n
DSJFKDAFJKDAFJDSAKFJADSFLKDLAFKDSAF\n
[more of the above, ending with a newline]\n
[yep, there is a variable number of lines here]\n
\n
(repeat the above a few hundred times).

I'd like to capture two things: the 'some_Varying_TEXT' part, and all of the lines of uppercase text that comes two lines below it in one capture (i can strip out the newline characters later). I've tried with a few approaches:

re.compile(r"^>(\w+)$$([.$]+)^$", re.MULTILINE) # try to capture both parts
re.compile(r"(^[^>][\w\s]+)$", re.MULTILINE|re.DOTALL) # just textlines

and a lot of variations hereof with no luck. The last one seems to match the lines of text one by one, which is not what I really want. I can catch the first part, no problem, but I can't seem to catch the 4-5 lines of uppercase text. I'd like match.group(1) to be some_Varying_Text and group(2) to be line1+line2+line3+etc until the empty line is encountered.

If anyone's curious, its supposed to be a sequence of aminoacids that make up a protein.

7 Answers

Try this:

re.compile(r"^(.+)\n((?:\n.+)+)", re.MULTILINE)

I think your biggest problem is that you're expecting the ^ and $ anchors to match linefeeds, but they don't. In multiline mode, ^ matches the position immediately following a newline and $ matches the position immediately preceding a newline.

Be aware, too, that a newline can consist of a linefeed (\n), a carriage-return (\r), or a carriage-return+linefeed (\r\n). If you aren't certain that your target text uses only linefeeds, you should use this more inclusive version of the regex:

re.compile(r"^(.+)(?:\n|\r\n?)((?:(?:\n|\r\n?).+)+)", re.MULTILINE)

BTW, you don't want to use the DOTALL modifier here; you're relying on the fact that the dot matches everything except newlines.

This will work:

>>> import re
>>> rx_sequence=re.compile(r"^(.+?)\n\n((?:[A-Z]+\n)+)",re.MULTILINE)
>>> rx_blanks=re.compile(r"\W+") # to remove blanks and newlines
>>> text="""Some varying text1
...
... AAABBBBBBCCCCCCDDDDDDD
... EEEEEEEFFFFFFFFGGGGGGG
... HHHHHHIIIIIJJJJJJJKKKK
...
... Some varying text 2
...
... LLLLLMMMMMMNNNNNNNOOOO
... PPPPPPPQQQQQQRRRRRRSSS
... TTTTTUUUUUVVVVVVWWWWWW
... """
>>> for match in rx_sequence.finditer(text):
...   title, sequence = match.groups()
...   title = title.strip()
...   sequence = rx_blanks.sub("",sequence)
...   print "Title:",title
...   print "Sequence:",sequence
...   print
...
Title: Some varying text1
Sequence: AAABBBBBBCCCCCCDDDDDDDEEEEEEEFFFFFFFFGGGGGGGHHHHHHIIIIIJJJJJJJKKKK

Title: Some varying text 2
Sequence: LLLLLMMMMMMNNNNNNNOOOOPPPPPPPQQQQQQRRRRRRSSSTTTTTUUUUUVVVVVVWWWWWW

Some explanation about this regular expression might be useful: ^(.+?)\n\n((?:[A-Z]+\n)+)

  • The first character (^) means "starting at the beginning of a line". Be aware that it does not match the newline itself (same for $: it means "just before a newline", but it does not match the newline itself).
  • Then (.+?)\n\n means "match as few characters as possible (all characters are allowed) until you reach two newlines". The result (without the newlines) is put in the first group.
  • [A-Z]+\n means "match as many upper case letters as possible until you reach a newline. This defines what I will call a textline.
  • ((?:textline)+) means match one or more textlines but do not put each line in a group. Instead, put all the textlines in one group.
  • You could add a final \n in the regular expression if you want to enforce a double newline at the end.
  • Also, if you are not sure about what type of newline you will get (\n or \r or \r\n) then just fix the regular expression by replacing every occurrence of \n by (?:\n|\r\n?).

The following is a regular expression matching a multiline block of text:

import re
result = re.findall('(startText)(.+)((?:\n.+)+)(endText)',input)

If each file only has one sequence of aminoacids, I wouldn't use regular expressions at all. Just something like this:

def read_amino_acid_sequence(path):
    with open(path) as sequence_file:
        title = sequence_file.readline() # read 1st line
        aminoacid_sequence = sequence_file.read() # read the rest

    # some cleanup, if necessary
    title = title.strip() # remove trailing white spaces and newline
    aminoacid_sequence = aminoacid_sequence.replace(" ","").replace("\n","")
    return title, aminoacid_sequence

find:

^>([^\n\r]+)[\n\r]([A-Z\n\r]+)

\1 = some_varying_text

\2 = lines of all CAPS

Edit (proof that this works):

text = """> some_Varying_TEXT

DSJFKDAFJKDAFJDSAKFJADSFLKDLAFKDSAF
GATACAACATAGGATACA
GGGGGAAAAAAAATTTTTTTTT
CCCCAAAA

> some_Varying_TEXT2

DJASDFHKJFHKSDHF
HHASGDFTERYTERE
GAGAGAGAGAG
PPPPPAAAAAAAAAAAAAAAP
"""

import re

regex = re.compile(r'^>([^\n\r]+)[\n\r]([A-Z\n\r]+)', re.MULTILINE)
matches = [m.groups() for m in regex.finditer(text)]

for m in matches:
    print 'Name: %s\nSequence:%s' % (m[0], m[1])

My preference.

lineIter= iter(aFile)
for line in lineIter:
    if line.startswith( ">" ):
         someVaryingText= line
         break
assert len( lineIter.next().strip() ) == 0
acids= []
for line in lineIter:
    if len(line.strip()) == 0:
        break
    acids.append( line )

At this point you have someVaryingText as a string, and the acids as a list of strings. You can do "".join( acids ) to make a single string.

I find this less frustrating (and more flexible) than multiline regexes.

It can sometimes be comfortable to specify the flag directly inside the string, as an inline-flag:

"(?m)^A complete line$".

For example in unit tests, with assertRaisesRegex. That way, you don't need to import re, or compile your regex before calling the assert.

Related